CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set 03

Practice CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set 03 provided below. The MCQ Questions for Class 12 Chapter 5 Molecular Basis of Inheritance Biology with answers and follow the latest CBSE/ NCERT and KVS patterns. Refer to more Chapter-wise MCQs for CBSE Class 12 Biology and also download more latest study material for all subjects

MCQ for Class 12 Biology Chapter 5 Molecular Basis of Inheritance

Class 12 Biology students should review the 50 questions and answers to strengthen understanding of core concepts in Chapter 5 Molecular Basis of Inheritance

Chapter 5 Molecular Basis of Inheritance MCQ Questions Class 12 Biology with Answers

Question. Purines found both in DNA and RNA are
a) cytosine and thymine
b) adenine and thymine
c) adenine and guanine
d) guanine and cytosine.

Answer : C

Question. Which of the following is initiation codon?
a) UAG
b) AUC
c) AUG
d) CCU

Answer : C

Question. Genes which are active all the time synthesizing substances needed by the cell are called
a) Cellular luxury genes
b) metabolic genes
c) house keeping genes
d) control genes

Answer : C

Question. The removal of which enzyme affects the synthesis of hnRNA in eukaryotes
a) RNA polymerase II
b) RNA primase
c) RNA polymerase III
d) RNA polymerase I

Answer : A

Question. Ribosomal RNA is actively synthesised in
a) lysosomes
b) nucleolus
c) nucleoplasm
d) ribosomes.

Answer : B

Question. In DNA helix, cytosine is paired with guanine by
a) covalent bond
b) phosphate bond
c) three hydrogen bonds
d) two hydrogen bonds

Answer : C

Question. Protein synthesis in an animal cell, takes place
a) in the cytoplasm as well as endoplasmic reticulum
b) only on ribose attached to nucleon
c) only in the cytoplasm
d) in the nucleolus as well as in the cytoplasm.

Answer : D

Question. All of the following are part of an operon except
a) an operator
b) structural genes
c) an enhancer
d) a promoter.

Answer : C

Question. In DNA, when AGCT occurs, their association is as per which of the following pair?
a) AT-GC
b) AG-CT
c) AC-GT
d) All of these

Answer : A

Question. In three dimensional view the molecule of tRNA is
a) L-shaped
b) S-shaped
c) Y-shaped
d) E-shaped.

Answer : A

Question. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
a) AUGUUAAUAGACGAGUAGCGACGAUGU
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG

Answer : B

Question. ‘Lac operon’ in E. coli, is induced by
a) ‘I’ gene
b) promoter gene
c) β-galactosidase
d) lactose.

Answer : C

Question. The following ratio is generally constant for a given species:
a) A + G / C + T
b) T + C / G + A
c) G + C / A + T
d) A + C / T + G.

Answer : C

Question. In prokaryotes, the genetic material is
a) linear DNA without histones
b) circular DNA without histones
c) linear DNA with histones
d) circular DNA with histones.

Answer : B

Question. Cistron is
a) The coding sequence of DNA
b) The functional unit of DNA molecule that codes for a particular gene product
c) Intervening non coding sequence of DNA
d) The sequences which are removed during RNA splicing.

Answer : B

Question. Read the statements given below and identify the incorrect statement.
a) The human genome contains 3164.7 million nucleotide bases.
b) The average gene consists of 30,000 bp
c) The total number of genes is estimated at 30,000.
d) Chromosome Y has 231 genes
e) Less than 2% of the genome codes for proteins.

Answer : B

Question. Using imprints from a plate with complete medium and carrying bacterial colonies, you can select streptomycin resistant mutants and prove that such mutations do not originate as adaptation. These imprints need to be used
a) on plates with and without streptomycin
b) on plates with minimal medium
c) only on plates with streptomycin
d) only on plates without streptomycin.

Answer : C

Question. In E. coli, during lactose metabolism repressor binds to
a) regulator gene
b) operator gene
c) structural gene
d) promoter gene.

Answer : B

Question. The stretch of codons between AUG and a stop codon is called
a) open reading frame
b) TATA box
c) colinearity
d) degenerate

Answer : A

Question. If a DNA contains 1000 base pairs, what would be its length?
a) 3400 Å
b) 34000 Å
c) 6800
d) 1000 Å

Answer : A

Question. Peptidyl transferase
a) Is a 23s rRNA
b) forms peptide bonds
c) component of ribosome
d) all the three

Answer : D

Question. Experimental material in the study of DNA replication has been
a) Escherichia coli
b) Neurospora crassa
c) Pneumococcus
d) Drosophila melanogaster.

Answer : A

Question. Which one of the following statements about the particular entity is true ?
a) Centromere is found in animal cells, which produces aster during cell division.
b) The gene for producing insulin is present in every body cell.
c) Nucleosome is formed of nucleotides.
d) DNA consists of core of eight histones

Answer : B

Question. One turn of the helix in a B-form DNA is approximately
a) 2 nm
b) 20 nm
c) 0.34 nm
d) 3.4 nm.

Answer : D

Question. DNA synthesis can be specifically measured by estimating the incorporation of radio-labelled
a) thymidine
b) deoxyribose sugar
c) uracil
d) adenine.

Answer : A

Question. If a double stranded DNA has 20% Thymine, the percentage of Guanine in the DNA
a) 30%
b) 10%
c) 90%
d) 40%

Answer : A

Question. Which of the following reunites the exon segments after RNA splicing?
a) RNA polymerase
b) RNA primase
c) RNA ligase
d) RNA proteoses

Answer : C

Question. If the DNA codons are ATG ATG ATG and a cytosine base is inserted at the beginning, then which of the following will result?
a) CAT GAT GAT G
b) A non-sense mutation
c) C ATG ATG ATG
d) CA TGA TGA TG

Answer : A

Question. Structural and catalytic role is of which RNA?
a) m RNA
b) t RNA
c) r RNA
d) hn RNA

Answer : C

Question. The final proof for DNA as the genetic material came from the experiments of
a) Hershey and Chase
b) Avery, MacLeod and McCarty
c) Hargobind Khorana
d) Griffith.

Answer : A

Question: The E. Coli used by Meselson and Stahl for proving semiconservative nature of replication were initially grown in medium containing
a) 35S
b) 15NH4Cl
c) 32P
d) 15C
Answer: b

Question: During transcription base pairing between DNA template strand and new RNA strand is
a) A–T, G–C
b) A–C, G–T
c) A–G, T–C
d) None of these
Answer: d

Question: Main enzyme for transcription is
a) RNA dependent – DNA Polymerase
b) DNA dependent – DNA polymerase
c) DNA dependent – RNA polymerase
d) DNA ligase
Answer: c

Question: Polyploidy takes place in a cell when
a) If transcription takes place but cell division doesn’t take place
b) If replication takes place but transcription doesn’t take place
c) If replication takes place but cell division doesn’t take place
d) If replication and cell division doesn’t take place
Answer: c

Question: Transcription takes place on
a) Both the DNA strand simultaneously
b) Coding strand
c) Template strand
d) None of the above
Answer: c

Question: Long DNA replication takes place only within a small opening called replication fork because
a) Opening of whole DNA throughout the length needs a lot of time
b) Opening of whole DNA throughout the length needs a lot of energy
c) At one time in a cell only a small DNA part is replicated
d) None of these
Answer: b

Question: Why N15 isotope of nitrogen was taken in Stahl experiment?
a) It is radioactive
b) It is heavy than 14N– isotope and can be separated on the base of density
c) It can be separated based on radioactivity
d) Both (a) and (c)
Answer: b

Question: If newly transcribed RNA have sequence 5’AUUCGUA3’ the coding sequence will be
a) 5’CGGATT3’
b) 3’GCCTAA5’
c) 3’AATCCG5’
d) 5’ATTCGTA3’
Answer: d

Question: Transcription unit is located on
a) m RNA molecule
b) DNA molecule
c) r RNA molecule
d) t RNA molecule
Answer: b

Question: Taylor and colleagues in 1958 experimented on which plant for proving replication is semiconservative
a) Pisum sativum
b) Vicia fabia
c) Hibiscus rosasinesis
d) None of the above
Answer: b

Question: The average replication rate is around
a) 2000 bp/sec
b) 2 kbp/sec
c) 2 × 106 bp/sec
d) None of these
Answer: a

Question: RNA synthesis takes place on a single DNA strand because
a) Two strands have different sequences; transcribing both forms different proteins
b) The RNA strands from both would be complementary and form dsRNA
c) Both of these
d) None of these
Answer: c

Question: A sequence of DNA to be transcribed is 5’TTACCGAT–3’ coding strand 3’AATGGCTA–5’ template strand. What will be the sequence of transcribed mRNA?
a) UUACCGAU
b) AAUGGCUA
c) TTUGGCUT
d) All of these
Answer: a

Question: Enzymes that joins fragments of the DNA strand synthesized by discontinuous synthesis
a) Helicase
b) DNA ligase
c) DNA polymerase
d) Telomerase
Answer: b

Question: dNTPs importance in replication is
a) Serves as substrate
b) Activates polymerase
c) Gives energy for strand separation
d) Both (a) and (c)
Answer: d

MCQs for Chapter 5 Molecular Basis of Inheritance Biology Class 12

Students can use these MCQs for Chapter 5 Molecular Basis of Inheritance to quickly test their knowledge of the chapter. These multiple-choice questions have been designed as per the latest syllabus for Class 12 Biology released by CBSE. Our expert teachers suggest that you should practice daily and solving these objective questions of Chapter 5 Molecular Basis of Inheritance to understand the important concepts and better marks in your school tests.

Chapter 5 Molecular Basis of Inheritance NCERT Based Objective Questions

Our expert teachers have designed these Biology MCQs based on the official NCERT book for Class 12. We have identified all questions from the most important topics that are always asked in exams. After solving these, please compare your choices with our provided answers. For better understanding of Chapter 5 Molecular Basis of Inheritance, you should also refer to our NCERT solutions for Class 12 Biology created by our team.

Online Practice and Revision for Chapter 5 Molecular Basis of Inheritance Biology

To prepare for your exams you should also take the Class 12 Biology MCQ Test for this chapter on our website. This will help you improve your speed and accuracy and its also free for you. Regular revision of these Biology topics will make you an expert in all important chapters of your course.

FAQs

Where can I access latest CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set 03?

You can get most exhaustive CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set 03 for free on StudiesToday.com. These MCQs for Class 12 Biology are updated for the 2026-27 academic session as per CBSE examination standards.

Are Assertion-Reasoning and Case-Study MCQs included in the Biology Class 12 material?

Yes, our CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set 03 include the latest type of questions, such as Assertion-Reasoning and Case-based MCQs. 50% of the CBSE paper is now competency-based.

How do practicing Biology MCQs help in scoring full marks in Class 12 exams?

By solving our CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set 03, Class 12 students can improve their accuracy and speed which is important as objective questions provide a chance to secure 100% marks in the Biology.

Do you provide answers and explanations for CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set 03?

Yes, Biology MCQs for Class 12 have answer key and brief explanations to help students understand logic behind the correct option as its important for 2026 competency-focused CBSE exams.

Can I practice these Biology Class 12 MCQs online?

Yes, you can also access online interactive tests for CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set 03 on StudiesToday.com as they provide instant answers and score to help you track your progress in Biology.